The viral capsid protein, p7a and p7b CDS were the most frequently mapped domains followed by the replicase CDS, while p32 CDS domain showed moderate mapping (Figure 3a). In Kenya, the disease was first reported in Bomet county and it has since spread to other regions of the country as well as neighbouring countries including Tanzania, Rwanda, Burundi, Ethiopia and Uganda (Mahuku et al., 2015; Wamaitha et al., 2018). NC_003398.1). The values presented are log of relative expression (Log 2, Identification of MLND causal viruses in alternative hosts using semiquantitative RT‐PCR. Since our interest was to capture siRNAs at all stages of the disease progression, there is a high possibility that the concentration of viral‐sourced miRNAs will vary at different stages of infection/disease progression in the pooled subsamples. Primers from 2 (SCMV P3 and MCMV capsid protein) validated markers in sRNA‐Seq and qPCR (Table S1) above were used alongside PPDK (FP 5'CGCGACGAATTAACAACGCT3' and RP 5'ATCGTGTTGCTAGCGTCCAA3') to confirm the success of library preparation. They also recommend not moving infected maize plants and seeds to disease-free areas. If you do not receive an email within 10 minutes, your email address may not be registered, However, SCMV had 14 miRNAs all having UPE values of −1. Any opinions, findings, conclusion or recommendations expressed in this publication are those of the authors and do not necessarily reflect the view of CGIAR Research Program on MAIZE or its funders. Several tools applied in MLND surveillance include double‐antigen sandwich–enzyme‐linked immunosorbent assay (DAS‐ELISA) and real‐time polymerase chain reaction (Fatma et al., 2016), but these could have limited success due to the viral divergence across regions (Braidwood, Müller, & Baulcombe, 2019) as well us low sensitivity in maize seeds due to low viral titres (Quito‐Avila, Alvarez, & Mendoza, 2016). Other viruses including MYMV were also detected although their assembly was poor. A total of 17 plant species were collected and screened for MLND causal viruses. The samples were taken to the laboratory and kept at −80°C to await RNA extraction. This was done to avoid bias based on the length disparity with reference to the length of mature peptide domains (mtr‐PD) or the CDS. (2019) that miR159, miR393 and miR394 may be involved in antiviral defence mechanisms against co‐infecting viruses, the same study noted that these miRNAs are down‐regulated. Disease is associated with the presence of maize thrips and the growth of several crops of maize annually. Finally, the entire plant dries out and dies. Genome assembly of host‐filtered sRNAs was performed using VirusDetect pipeline (Zheng et al., 2017) and contigs with a coverage >75% reported. Because the stable food crops in Africa are also hosts of MLN causal viruses and the continent is yet to be self‐reliant in terms of food, there is still an imminent risk of introduction of other SCMV isolates from other regions through importation of food and feed. • An intensive multi-disciplinary and multi-institutional strategy is being implemented to curb the spread of MLN in sub-Saharan Africa, and mitigate the impact of the disease. To confirm further the possibility of capsid protein and p3 marker for MCMV and SCMV that amplified a 116 and 164 bp fragment, we mapped their sequences to Zea mays genome through NCBI and Sequence Manipulation Suite (https://www.bioinformatics.org/sms2/) which did not return any results. Recently, metagenomic analysis identified viruses that had never been associated with MLND which include mastrevirus, totiviruses and poleroviruses (Wamaitha et al., 2018). This by itself will cause only minor damage on maize, but when another potyvirus of cereals, such as SCMV, wheat streak mosaic virus (WSMV) or maize dwarf mosaic virus … Blue tracks represent the best hit reference virus genomes from GenBank database, and red tracks represent assembled virus contigs. These hypervariabilities in the SCMV genome like many other potyviruses will continue to be a challenge in the development of robust detection tools for the virus which is a major contributor to MLN in Africa. (2012), repeat sequences are difficult to assemble as high‐identity reads could come from different portions of the genome, generating gaps, ambiguities and collapses in alignment and assembly. MLND can also cause dwarfing and premature aging of the plants. A well‐characterized role of MCMV's capsid protein is its terminal‐encoded amino acids which allow subcellular localizations of MCMV (Zhan, Lang, Zhou, & Fan, 2016). Enter your email address below and we will send you your username, If the address matches an existing account you will receive an email with instructions to retrieve your username, Identification of the MLND‐causing viruses by VirusDetect using siRNA size profiles from one per region (consisting of six pooled representative subsamples). Our results and those of Wamaitha et al. In this study, we report the use of small RNA (sRNA) profiling to detect MLND causal viruses and further the development of alternative detection markers for use in routine surveillance of the disease‐causing viruses. NC_003627.1). A complete MSV genome was also assembled from the pooled samples collected in Kericho. This study focused on understanding the extent of MLN spread in north-central regions of Tanzania by … Management of MLND requires effective resistance screening and surveillance tools. Recently, findings by Braidwood et al. MCMV and SCMV have previously been reported to infect members of the grass family including millet and sorghum (Scheets, 2004; Toler, 1985). Complete Refseq genomes for MCMV (NC_003627.1) and SCMV (NC_003398.1) were retrieved from National Centre for Biotechnology Information (NCBI) and used for mapping, annotation and identification of highly expressed domains of the viruses based on host‐filtered siRNAs. The real‐time PCRs were done in triplicates for each sample. Occurrence of maize lethal necrosis in Ecuador: A disease without boundaries? Insect Management: If possible it is good to spray suspected or … The necrotic symptoms occur at different stages of maize development and can lead to 100% crop loss. Google Scholar. Maize lethal necrosis was first identified in the USA in 1976 (Niblett and Caflin, 1978). Licensed under CC-BY-SA License statement/permission on Wikimedia Commons. We greatly appreciate the editorial assistance of CIMMYT The rest of the regions tested recorded relative expression of